View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_45 (Length: 371)
Name: NF0816_low_45
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 31168964 - 31169331
Alignment:
| Q |
1 |
ttctaagatgatccttgcaaagtgtaaatcaaatttgttattatttttggatttattgtcaaatgcacccctaacattgttcacttggtttcaaattctt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
31168964 |
ttctaagatgatccttgcaaagtgttaatcaaatttgttattatttttggatttattgtcaaatgcactcctaacattgttcactcggtttcaaattctt |
31169063 |
T |
|
| Q |
101 |
ctctgatattacctaatgtacccataacattattcattgtgtttcaaattcaaatccgatattgcctacttaatatcattgcaaataccaatggaagggt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31169064 |
ctctgatattacctaatgtacccctaacattattcattgtgtttcaaattcaaatccgatattgcctacttaatatcattgcaaataccaatggaagggt |
31169163 |
T |
|
| Q |
201 |
gactttgattacattttgcaactttaagattcattttagaatagcgacaatgtaggggacaagattgatataatcctataatttcaaagacaaatttagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31169164 |
gactttgattacattttgcaactttaagattcattttagaatagcgacaatgtaggggacaagattgatataatcctataatttcaaagacaaatttagg |
31169263 |
T |
|
| Q |
301 |
tatttgcttcattatgtgagggtgattgttgaatttgattacaactttttggatatattattcgacat |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
31169264 |
tatttgcttcattatgtgagggtgattgttgaatttgattacaactttttggatatactatttgacat |
31169331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7016 times since January 2019
Visitors: 5773