View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_46 (Length: 371)
Name: NF0816_low_46
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 91 - 360
Target Start/End: Original strand, 23683429 - 23683698
Alignment:
| Q |
91 |
accaacatcatcaaaaggggatgcccacaatatggtctttaagctgagagaaatttacagcattcagaaatccccttttgtcgctcaaatgttcatgtgt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23683429 |
accaacatcatcaaaaggggatgcccacaatatggtctttaagctgagagaaatttacagcattcagaaatccccttttgtcgctcaaatgttcatgtgt |
23683528 |
T |
|
| Q |
191 |
gcatagattatatatcttcagatttcacatctggagtgtggaaagcgtctcaactcacaagtgaagaaagaacaagcatagaaaactatgtactcaactc |
290 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23683529 |
gcaaagattatatatcttcagatttcacatctggagtgtggaaagcatctcaactcacaagtgaagaaagaacaagcatagaaaactatgtactcaactc |
23683628 |
T |
|
| Q |
291 |
ctcaccgaaagtcttttcaacaatagaaatgaaagggagaaaaattttctgtcgatattcaggggttcat |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
23683629 |
ctcaccgaaagtcttttcaacaatagaaatgaaagggagaaaatttttctgtcaatattcaggggttcat |
23683698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6681 times since January 2019
Visitors: 5770