View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_55 (Length: 355)
Name: NF0816_low_55
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 30 - 338
Target Start/End: Original strand, 35696724 - 35697032
Alignment:
Q |
30 |
acgatgagaagcatgccgatgtattcggagcttagttcttcggctgttgaatattatgatataacgaagcctaacaaacagaatcaaaactatgacaata |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35696724 |
acgatgagaagcatgccgatgtattcggagcttagttcttcggctgttgaatattatgatataacgaagcctaacaaacagaatcaaaactatgacaata |
35696823 |
T |
 |
Q |
130 |
acagtaattgtgatgccaagcatatgatgacgcttcaacgatcacaaagcgnnnnnnntgattcgacgattaatgattatgtttataatcctaatggaaa |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35696824 |
acagtaattgtgatgccaagcatatgatgacgcttcaacgatcacaaagcgaaaaaaatgattcgacgattaatgattatgtttataatcctaatggaaa |
35696923 |
T |
 |
Q |
230 |
aaacggttacggtggtgaatgtgagtctgaaattagtgttcctactgggaagaaaggtgtgatcgtgaacgcgaatggatcgttgtgttcggatgttgga |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35696924 |
aaacggttacggtggtgaatgtgagtctgaaattagtgttcctactgggaagaaaggtgtgatcgtgaacgcgaatggatcgttgtgttcggatgttgga |
35697023 |
T |
 |
Q |
330 |
ccttcaccg |
338 |
Q |
|
|
||||||||| |
|
|
T |
35697024 |
ccttcaccg |
35697032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6598 times since January 2019
Visitors: 5769