View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_56 (Length: 354)
Name: NF0816_low_56
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 59 - 346
Target Start/End: Original strand, 40539136 - 40539420
Alignment:
| Q |
59 |
gtttaaatattggattttgatcaaaacttgctaacaaaaccattaagctttttataatggtttctttaatttgttccatcatcaattgactatgttaaca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40539136 |
gtttaaatattggattttgatcaaaacttgctaacaaaaccattaagctttttataatggtttctttaatttgttccatc---aattgactatgttaaca |
40539232 |
T |
|
| Q |
159 |
tgtgtcacacggacattatagatggaaaactcatgcacccttcactacactattattagtctagtaacaaccattttgcaaacgactaagttctagtttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40539233 |
tgtgtcacacggacattatagatggaaaactcatgcacccttcactacactattattagtctagtaacaaccattttgcaaacgactaagttctagtttc |
40539332 |
T |
|
| Q |
259 |
ctatgcctatttactcttgcaatgaaatcttcagcccttctactcaattcatcagaacaagaagcaaccgaattactttgttcatctc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
40539333 |
ctatgcctatttactcttgcaatgaaatcttcagcccttctactcaattcatcagaacgaaaagcaaccgaattactttgttcatctc |
40539420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7058 times since January 2019
Visitors: 5773