View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_59 (Length: 353)
Name: NF0816_low_59
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 95 - 277
Target Start/End: Complemental strand, 32672614 - 32672431
Alignment:
Q |
95 |
ctctagctctgatagagaagcccccatttcacttcatatgctatatgttgtgctcattcatgcatgctttcttttctttatatacaaaacaataatatta |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32672614 |
ctctagctctgatagagaagcccccatttcacttcatatgctatatgttgtgctcattcatgcatgctttcttttctttatatacaaaacaataatatta |
32672515 |
T |
 |
Q |
195 |
ctttagaaaggaatattaatatgtatatattctctataactcgattcagaccgtaagttgatggtggagaata-ttgtctgttc |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
32672514 |
ctttagaaaggaatattaatatgtatatattctctataactcgattcagaccgtaagttgatggtggagaatatttgtctgttc |
32672431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 297 - 342
Target Start/End: Complemental strand, 32672393 - 32672348
Alignment:
Q |
297 |
gcaaatgataacgttcatgtcttaacaatgatgcttgtctatctct |
342 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32672393 |
gcaaatgataacgttcatgtcttaacaatgatgcttgtctatctct |
32672348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University