View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_64 (Length: 343)
Name: NF0816_low_64
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 64 - 265
Target Start/End: Original strand, 1844457 - 1844658
Alignment:
| Q |
64 |
ctgatatgaaaaccttatagttataaaccacnnnnnnnnngtgatgtaatatgctcaactatatgctttttgaacatatgttctcaggtttacacaggtt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1844457 |
ctgatatgaaaaccttatagttataaaccactttttttttgtgatgtaatatgctcaactatatgctttttgaacatatgttctcaggtttacacaggtt |
1844556 |
T |
 |
| Q |
164 |
tatttgataaactgatacctttggagtatagtatgtnnnnnnnnttaagatactggtactctttcacttcagtatactctactctcacttcaaaatcctt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1844557 |
tatttgataaactgatacctttggagtatagtatgtaaaaaaaattaagatactggtactctttcacttcagtatactctactctcacttcaaaatcctt |
1844656 |
T |
 |
| Q |
264 |
tg |
265 |
Q |
| |
|
|| |
|
|
| T |
1844657 |
tg |
1844658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University