View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_65 (Length: 343)
Name: NF0816_low_65
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 30 - 339
Target Start/End: Original strand, 10191901 - 10192210
Alignment:
| Q |
30 |
ttttgatcactgattgggcttggacacttgcaaaaacaggaaaaattcatgaaatatttgatcaagcagttaaagatgaagggccagagaaaatcatgga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10191901 |
ttttgatcactgattgggcttggacacttgcaaaaacaggaaaaattcatgaaatatttgatcaagcagttaaagatgaagggccagagaaaatcatgga |
10192000 |
T |
|
| Q |
130 |
aagatttgtacttgttggaattctttgtgctcatgcaatggttgcattaagacctacaattgctgaggcaattaagatgttagaaggtgatattgatata |
229 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10192001 |
aagatttgtgcttgttggaattctttgtgctcatgcaatggttgcattaagacctacaattgctgaggcaattaagatgttagaaggtgatattgatata |
10192100 |
T |
|
| Q |
230 |
cctaatttaccagataggcctgttccacttggtcatgaatcttttcaatcttctcttttgaatggtatgcaaagtggaagatcaacaccttattataatt |
329 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10192101 |
cctaatttacctgataggcctgttccacttggtcatgaatcttttcaatcttctcttttgaatggtatgcaaagtggaagatcaacaccttattataatt |
10192200 |
T |
|
| Q |
330 |
catctcactc |
339 |
Q |
| |
|
||||| |||| |
|
|
| T |
10192201 |
catcttactc |
10192210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 125 - 225
Target Start/End: Original strand, 718821 - 718921
Alignment:
| Q |
125 |
atggaaagatttgtacttgttggaattctttgtgctcatgcaatggttgcattaagacctacaattgctgaggcaattaagatgttagaaggtgatattg |
224 |
Q |
| |
|
|||||||| ||| |||||||||||||||| ||| |||||| ||||||||| || || || |||||| | || || | |||||||| ||||||||||||| |
|
|
| T |
718821 |
atggaaaggtttttacttgttggaattctatgttctcatgtaatggttgctttgaggccaacaatttccgatgctttgaagatgttggaaggtgatattg |
718920 |
T |
|
| Q |
225 |
a |
225 |
Q |
| |
|
| |
|
|
| T |
718921 |
a |
718921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5910 times since January 2019
Visitors: 5761