View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_68 (Length: 333)
Name: NF0816_low_68
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 4066973 - 4066651
Alignment:
Q |
1 |
ttgtttatattttattagggagtgagttatttagttgggacaatgttatagatacatcagttagtgacacaaaatttcacatgttttgaaataatattac |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4066973 |
ttgtttatattttattagggagtgagttatttatttgggacaatgttatagatacataagttagtgacacaaaatttcacatgttttgaaataatattac |
4066874 |
T |
 |
Q |
101 |
atgattagacttatttaccttttggacttatgttagggtactatatcgacgtctaatttagtaactatgcatgctacttgtctctctatactttttattt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4066873 |
atgattagacttatttaccttttggacttatgttagggtactatatcgacgtctaatttagtaactatgcatgctacttgtctctctatactttttattt |
4066774 |
T |
 |
Q |
201 |
atttatatgtagacagacacttcttattaaaggtgtgtttgatgtttgacatcgatatatgtaattacattcactagtatgaatgtgtcggtgtcgtgtt |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
4066773 |
atttatatgtagacagacacttcttattaaaggtgtgtttggtgtttgacatcgatatatgtaattacattcactagtataaatgtgtcggtgtcgtgtt |
4066674 |
T |
 |
Q |
301 |
tggtattcttttctaggtctgtg |
323 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
4066673 |
tggtattcttttctaggtctgtg |
4066651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University