View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_70 (Length: 333)
Name: NF0816_low_70
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 30 - 176
Target Start/End: Complemental strand, 41127237 - 41127087
Alignment:
Q |
30 |
gatgtcaggtaacaaatcaacatacacgttgctgtgtactagaatgaatcaaatcatattatatata----gtaagagtttggtcatgtacgtaaataaa |
125 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
41127237 |
gatgtcaggtaacaaatcaacatacacgttgctgtgtactaaaatgaatcaaatcatattatatatatatagtaagagtttggtcatgtacgtaaataaa |
41127138 |
T |
 |
Q |
126 |
caaataacagactgaaactgggcatgcccatgtgagattccaatttggatg |
176 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41127137 |
caaataacagactgaaactgggcatgcccatgtgagattccaatttggatg |
41127087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 257 - 325
Target Start/End: Complemental strand, 41127002 - 41126934
Alignment:
Q |
257 |
gtatgttgagataatggcgtctgtttcttatatcagagaggaccagacaaataaatttacattcatctc |
325 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41127002 |
gtatgttgagataatggcgtctgtttcttatatcagagaggaccagacaaataaatttacattcatctc |
41126934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6667 times since January 2019
Visitors: 5770