View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_low_79 (Length: 308)

Name: NF0816_low_79
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_low_79
NF0816_low_79
[»] chr2 (2 HSPs)
chr2 (30-165)||(2410486-2410621)
chr2 (202-295)||(2410618-2410711)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 30 - 165
Target Start/End: Original strand, 2410486 - 2410621
Alignment:
30 atgaccaaaaccaaaatcaataaaacaagtcaggtctagaagatacccgaagaacaaaattcttgtaaattgcttcagaatcaaactcttcttcatgctt 129  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2410486 atgaccaaaaccaaaatcaataaagcaagtcaggtctagaagatacccgaagaacaaaattcttgtaaattgcttcagaatcaaactcttcttcatgctt 2410585  T
130 ttggtcacatcctgagaattgagttccaattatcaa 165  Q
    ||||||||||||||||||||||||||||||||||||    
2410586 ttggtcacatcctgagaattgagttccaattatcaa 2410621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 202 - 295
Target Start/End: Original strand, 2410618 - 2410711
Alignment:
202 tcaaaatgaaaacatctacaacactacatatccaatgtcagacacatatgtgaatgtctgacacggacacatgtcactattgtgtctggtgtct 295  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2410618 tcaaaatgaaaacatctacaacactgcatatccaatgtgagacacatatgtgaatgtctgacacggacacatgtcactattgtgtctggtgtct 2410711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5809 times since January 2019
Visitors: 5759