View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_80 (Length: 295)
Name: NF0816_low_80
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 34293651 - 34293885
Alignment:
| Q |
17 |
atgaagaacatatgaaacaaggaacattgatgtatatagttttccgcaaaaataggtcatctatgctatatttagataaaaacataagtctgtgacaatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34293651 |
atgaagaacatatgaaacaaggaacattgatgtatatagttttccgcaaaaataggtcatctatgctatatttagataacaacataagtctgtgacaatt |
34293750 |
T |
|
| Q |
117 |
taaaaaggaacacatgggcatttgaagcatttggtcacctattgaattgacgtgtttcaactcaaacatcgatgactcacagcatgaacacgatttttat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34293751 |
taaaaaggaacacatgggcatttgaagcatttggtcacctattgaattgacgtgtttcaactcaaacatcgatgactcacagcatgaacacgatttttat |
34293850 |
T |
|
| Q |
217 |
gctgttgagggaatcatgaacacttacgatatgtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34293851 |
gctgttgagggaatcatgaacacttacgatatgtg |
34293885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 100 - 225
Target Start/End: Original strand, 34303748 - 34303878
Alignment:
| Q |
100 |
ataagtctgtgacaatttaaaaaggaacacatggg-----catttgaagcatttggtcacctattgaattgacgtgtttcaactcaaacatcgatgactc |
194 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| || |||||||| || |||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
34303748 |
ataagtctatgacaatttgcaaaggaacacatgggacacgcaactgaagcatctgatcacctgttaaattgacttgtttcaactcaaacatcgatgactc |
34303847 |
T |
|
| Q |
195 |
acagcatgaacacgatttttatgctgttgag |
225 |
Q |
| |
|
||||||||||||| |||||| || ||||||| |
|
|
| T |
34303848 |
acagcatgaacacaatttttttgttgttgag |
34303878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6377 times since January 2019
Visitors: 5768