View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_81 (Length: 291)
Name: NF0816_low_81
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 7286863 - 7286689
Alignment:
| Q |
1 |
tgtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaatgaagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7286863 |
tgtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaacgaagaag |
7286764 |
T |
 |
| Q |
101 |
tacaaaattgaattataaaaatttaagaaaatgtgcataaggtctgcaaatagagaccgaaattgaggtgttcaa |
175 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7286763 |
tagaaaattgaattataaaaatttaagaaaatgtgcataaggtctgcaaatagagaccgaaattgaggtgttcaa |
7286689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 8357337 - 8357411
Alignment:
| Q |
2 |
gtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctc |
76 |
Q |
| |
|
||||||| | ||| |||||||||||| | ||| ||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8357337 |
gtgtaacttgatttcacattggaatgtttcctgaaatgaatatattgaaactgcaaaaatatccacaaatctctc |
8357411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 8365763 - 8365837
Alignment:
| Q |
2 |
gtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctc |
76 |
Q |
| |
|
||||||| | ||| |||||||||||||||||| |||||||||||| | |||| ||||||||||||||||| |||| |
|
|
| T |
8365763 |
gtgtaacttgatttcacattggaatggtccctgaaatgaatatatcgtaactacaaaaatatccacaaatttctc |
8365837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University