View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_85 (Length: 283)
Name: NF0816_low_85
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 85 - 247
Target Start/End: Original strand, 17782258 - 17782420
Alignment:
Q |
85 |
tgttgccagaggatccttatcaaagagctaaagttcgtttttgggccaactactttgatcagaaagtacacatcattcattactttctttctacttttct |
184 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17782258 |
tgttgccagaggatccttatcaaagagctaaagttcgtttttgggccaactactttgatcagaaagtacacatcattcattactttctttctacttttct |
17782357 |
T |
 |
Q |
185 |
tctatatttgcgatgatgttttcgacttaaagtgttttacaaataatttgttattgagtaaat |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17782358 |
tctatatttgcgatgatgttttcgacttaaagtgttttacaaataatttgttattgagtaaat |
17782420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University