View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_87 (Length: 282)
Name: NF0816_low_87
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_87 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 61 - 203
Target Start/End: Original strand, 29994133 - 29994275
Alignment:
| Q |
61 |
gatgtttaatgttaagttgatacattcaaaattattgttttcaaaattaaggttttacagatatattatttggtctt-aagttgaaacaaaaatgatcaa |
159 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29994133 |
gatgtttaatattaagttgatacattcaaaattactgttttcaaaattaaggtttt-cagatgtattatttggtctttaagttgaaacaaaagtgatcaa |
29994231 |
T |
|
| Q |
160 |
gtatttgatttataacatttatctctaaaattatgcttgaattc |
203 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29994232 |
gtacttgatttataacatttatttctaaaattatgcttgaattc |
29994275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 29994303 - 29994355
Alignment:
| Q |
230 |
ttatgtttgatgtcataagaactatttgacctaccacctcaacatgaaaggat |
282 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29994303 |
ttatgtttaatgtcataagaactatttgacctaccacctcaacatgaaaggat |
29994355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6866 times since January 2019
Visitors: 5772