View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_90 (Length: 276)
Name: NF0816_low_90
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_90 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 29 - 228
Target Start/End: Original strand, 35259844 - 35260043
Alignment:
| Q |
29 |
tagataatactcaaggcgctttcgcgattttatatttagaattttcactgaagagacttttgaaacctagaacatgattttgctattcctcaagtttatg |
128 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35259844 |
tagacaatactcgaggcgctttcgcgattttatatttagaattttcactgaagagacttttgaaacctagaacatgattttgctattcctcaagtttatg |
35259943 |
T |
 |
| Q |
129 |
ttatcatacttcatactttcannnnnnnnnnngtatagtacattatatatatgaacacattgtgaggaaactctgaaagcaggaggtactatatgtatat |
228 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35259944 |
ttatcatacttcatactttcatttttttttttgtatagtacattatatatatgaacacattgtgaggaaactctgaaagcaggaggtactatatgtatat |
35260043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University