View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_93 (Length: 273)
Name: NF0816_low_93
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 73 - 177
Target Start/End: Complemental strand, 31952230 - 31952122
Alignment:
Q |
73 |
cagaatgccagcactttcaatgacttttgtcatcctccttctgcagaagaaatcagaatagggac----attactcactacatcttggctgtatttgtaa |
168 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
31952230 |
cagaatgccagcactttcaatgacttttgtcatcctccttctgcagaagaaatcagaatagggacattaattactcactacatcttggctgtatttgtaa |
31952131 |
T |
 |
Q |
169 |
gttggtttg |
177 |
Q |
|
|
||||||||| |
|
|
T |
31952130 |
gttggtttg |
31952122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 31952263 - 31952229
Alignment:
Q |
16 |
ttcaagggagtcaatggatagaacactacaagtca |
50 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
31952263 |
ttcaagggagtcaatggatagaacactacaagtca |
31952229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7021 times since January 2019
Visitors: 5773