View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_94 (Length: 273)
Name: NF0816_low_94
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 31952764 - 31952935
Alignment:
| Q |
14 |
gagatttatgataatataaacataaccaaaatgagtttttggatgaaagagagagaaaggaactgatgatacctcagcgtagtggtcaatggtggtatca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31952764 |
gagatttatgataatataaacataaccaaaatgagttttcggatgaaagagagagaaaggaactgatgatacctcagcgcggtggtcaatggtggtatca |
31952863 |
T |
 |
| Q |
114 |
aaattgaacttgatagaatgtataaatgaatgagttgcttttgtagaggatgaagagatgaagatgatgatg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31952864 |
aaattgaacttgatagaatgtataaatgaatgagttgcttttgtagaggatgaagagatgaagatgatgatg |
31952935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 6800452 - 6800400
Alignment:
| Q |
131 |
atgtataaatgaatgagttgcttttgtagaggatgaagagatgaagatgatga |
183 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| |||||| |||| |
|
|
| T |
6800452 |
atgtataaatgaataagttggttttgtagaggatgaagagaggaagataatga |
6800400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University