View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_low_96 (Length: 271)

Name: NF0816_low_96
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_low_96
NF0816_low_96
[»] chr7 (1 HSPs)
chr7 (31-174)||(4563153-4563296)
[»] chr6 (1 HSPs)
chr6 (31-96)||(5027341-5027406)
[»] chr3 (1 HSPs)
chr3 (48-96)||(8011580-8011628)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 31 - 174
Target Start/End: Complemental strand, 4563296 - 4563153
Alignment:
31 agatgaaaagaaagaattgcagaagcagattggttgcatcactggattttttcatctctttgatcgccaccgtttcatcacaggacaacgcactactaaa 130  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
4563296 agatgaaaagaaagaattgcagaagcaaattggttgcatcactggattttttcagctctttgatcgccaccgtttcatcacaggacaacgcactactaaa 4563197  T
131 tacattcagaatgcatcttctttaggtattcaattattcatatc 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
4563196 tacattcagaatgcatcttctttaggtattcaattattcatatc 4563153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 96
Target Start/End: Complemental strand, 5027406 - 5027341
Alignment:
31 agatgaaaagaaagaattgcagaagcagattggttgcatcactggattttttcatctctttgatcg 96  Q
    |||||||||  |||||||||||||||| ||||| ||||| | |||||||||||| || ||||||||    
5027406 agatgaaaatcaagaattgcagaagcaaattggatgcattagtggattttttcagctatttgatcg 5027341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 96
Target Start/End: Complemental strand, 8011628 - 8011580
Alignment:
48 tgcagaagcagattggttgcatcactggattttttcatctctttgatcg 96  Q
    ||||||||||||||||||| || |||||| ||||||| |||||||||||    
8011628 tgcagaagcagattggttgtatgactggaatttttcagctctttgatcg 8011580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University