View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_high_25 (Length: 307)
Name: NF0817_high_25
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0817_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 3414258 - 3414171
Alignment:
| Q |
13 |
attctcgatcaataagttaaatatatgtatcatcataattaaggagttgaattagatgaactagaaaaataagagatatcaccatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414258 |
attctcgatcaataagttaaatatatgtatcatcataattaaggagttgaattagatgaactagaaaaataagagatatcaccatgat |
3414171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 3414097 - 3414048
Alignment:
| Q |
174 |
gtagatcaaatactttgaaaacaagctagagggctccaatatgaaaaaac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
3414097 |
gtagatcaaatactttgaaaacaagctagatggttccaatatgaaaaaac |
3414048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University