View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0817_high_25 (Length: 307)

Name: NF0817_high_25
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0817_high_25
NF0817_high_25
[»] chr6 (2 HSPs)
chr6 (13-100)||(3414171-3414258)
chr6 (174-223)||(3414048-3414097)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 3414258 - 3414171
Alignment:
13 attctcgatcaataagttaaatatatgtatcatcataattaaggagttgaattagatgaactagaaaaataagagatatcaccatgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3414258 attctcgatcaataagttaaatatatgtatcatcataattaaggagttgaattagatgaactagaaaaataagagatatcaccatgat 3414171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 3414097 - 3414048
Alignment:
174 gtagatcaaatactttgaaaacaagctagagggctccaatatgaaaaaac 223  Q
    |||||||||||||||||||||||||||||| || ||||||||||||||||    
3414097 gtagatcaaatactttgaaaacaagctagatggttccaatatgaaaaaac 3414048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6361 times since January 2019
Visitors: 5767