View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_high_29 (Length: 250)
Name: NF0817_high_29
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0817_high_29 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 5117188 - 5117429
Alignment:
| Q |
11 |
cacagaaacaaggaaattaatctcaagttgcaatacaatttcagtcctggttgtttgatgagcatgaagtttgtccaccggaag----aaacgcagtttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||| |||| |
|
|
| T |
5117188 |
cacagaaacaaggaaattaatctcaagttgcaatacaatttcagtcctggttgtttgatgagcatgaagtttctccaacggaagaaacaaacgcaatttt |
5117287 |
T |
 |
| Q |
107 |
tatgttatcagttggcaataggatgtactgtttttaagttttctcctttagctaataattatcatcaaatcataa-tttaaacttattatgtttaaacac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5117288 |
tatgttatcagttggcaataggatgtactgtttttaagttttctcctttagc---taattatcatcaaatcataattttaaactttttatgtttaaacac |
5117384 |
T |
 |
| Q |
206 |
aggtgaaattccattgtccctcttcaacatctcttctttgagagt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5117385 |
aggtgaaattccattgtccctcttcaacatctcttctttgagagt |
5117429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 198 - 249
Target Start/End: Original strand, 5099691 - 5099742
Alignment:
| Q |
198 |
ttaaacacaggtgaaattccattgtccctcttcaacatctcttctttgagag |
249 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5099691 |
ttaaatacaggtgaaattccattatccctcttcaacatctcttctttgagag |
5099742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 5082553 - 5082508
Alignment:
| Q |
204 |
acaggtgaaattccattgtccctcttcaacatctcttctttgagag |
249 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
5082553 |
acaggtgaaattcctgtatccctcttcagcatctcttctttgagag |
5082508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 47
Target Start/End: Original strand, 45621239 - 45621275
Alignment:
| Q |
11 |
cacagaaacaaggaaattaatctcaagttgcaataca |
47 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45621239 |
cacagtaacaaggaaattaatctcaagttgcaataca |
45621275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 14414533 - 14414489
Alignment:
| Q |
206 |
aggtgaaattccattgtccctcttcaacatctcttctttgagagt |
250 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
14414533 |
aggtgaaattccaatctccctcttcaacatctcttcgttgagagt |
14414489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 16877703 - 16877747
Alignment:
| Q |
205 |
caggtgaaattccattgtccctcttcaacatctcttctttgagag |
249 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
16877703 |
caggtgaaattccattctccctcttcaatatcacttctttgagag |
16877747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University