View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_high_31 (Length: 236)
Name: NF0817_high_31
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0817_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 37 - 157
Target Start/End: Complemental strand, 25792346 - 25792225
Alignment:
| Q |
37 |
ttactttcaatcactgattcacttatattttcttaaattactatcggtgtctaaatgtatgtgttgtatccggtgttcgtatgtggtggacactcttt-a |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25792346 |
ttactttcaatcactgattcacttatattttcttaaattactatcagtgtctaaatgtatgtgttgtatccggtgttcgtatgtggtggacactctttaa |
25792247 |
T |
 |
| Q |
136 |
gttctaatgaaatttatatatt |
157 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25792246 |
gttctaatgaaatttatatatt |
25792225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University