View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0817_high_31 (Length: 236)

Name: NF0817_high_31
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0817_high_31
NF0817_high_31
[»] chr7 (1 HSPs)
chr7 (37-157)||(25792225-25792346)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 37 - 157
Target Start/End: Complemental strand, 25792346 - 25792225
Alignment:
37 ttactttcaatcactgattcacttatattttcttaaattactatcggtgtctaaatgtatgtgttgtatccggtgttcgtatgtggtggacactcttt-a 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |    
25792346 ttactttcaatcactgattcacttatattttcttaaattactatcagtgtctaaatgtatgtgttgtatccggtgttcgtatgtggtggacactctttaa 25792247  T
136 gttctaatgaaatttatatatt 157  Q
    ||||||||||||||||||||||    
25792246 gttctaatgaaatttatatatt 25792225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University