View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_high_7 (Length: 406)
Name: NF0817_high_7
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0817_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 53 - 377
Target Start/End: Original strand, 35102987 - 35103315
Alignment:
| Q |
53 |
caggctactagtattggtcaggcttcgccatttccatctctatctctatattt----atttgtacacggtcacacttttttattttggtattagtcaatc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||| ||||||||||||||| ||||||||| || |
|
|
| T |
35102987 |
caggctactagtattggtcaggcttcgccatttccatctctatctctaaatttggttatttgtacatggtcgcacttttttattttgatattagtcagtc |
35103086 |
T |
|
| Q |
149 |
aacccggctctctcaatctttctgtaacatttacttctaactctttaattggtttaaggtaactannnnnnnccgatgtaggtttctatttaggcacgaa |
248 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||| |||| ||| | |
|
|
| T |
35103087 |
aaccctgctctctcaatttttctgtaacatttacttctaactctttaattggtttaaggatactatttttttccgatgtgggtttctatgtagggacgga |
35103186 |
T |
|
| Q |
249 |
tgtaatacaagtatgacattaattttttaaagcaattgaaaaatggaaaagaaccattgaagtaccttacgaccttcccacagtcgttgaatgttactat |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35103187 |
tgtaatacaagtatgacattaattttttaaagcaattgaaaaatggaaaagaactattgaagtaccttgcgaccttcccacagtcgttgaatgttactat |
35103286 |
T |
|
| Q |
349 |
gaggcatattcaattctacaagatgatat |
377 |
Q |
| |
|
|||||||||||||||| ||||||| |||| |
|
|
| T |
35103287 |
gaggcatattcaattccacaagataatat |
35103315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6500 times since January 2019
Visitors: 5768