View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_low_33 (Length: 252)
Name: NF0817_low_33
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0817_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 44984200 - 44983933
Alignment:
Q |
1 |
gctagatgttcaggtttgttgtctttgtgcattgcataatcatgagtcactcactatttgtatttttcacctttttggttgcgttacattttaacttctc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
44984200 |
gctagatgttcaggtttgttgtctttgtgcattgcataatcatgagtcactcactatttgtatttttcgcctttttggttgcgttacattttaacttctc |
44984101 |
T |
 |
Q |
101 |
aatttagattctaataaataagtatatgtgagctaagggtagttgtaa-------------------atactattctctagttgtgtgttaccttgtttt |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
T |
44984100 |
aatttagattctaataaataagtatatgtgagctaagggtagttgtaattattatgatatatgcattatactattctctagttgtgtgttacattgtttt |
44984001 |
T |
 |
Q |
182 |
gaatcaattttatgttacaattcagcttgagaagactgttcttttcctgttgcaacagctagggcttt |
249 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||| |
|
|
T |
44984000 |
gaatcaattttatgttacaattcagcttgagaagactgttcttttcctgttggaacaacaagggcttt |
44983933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5345 times since January 2019
Visitors: 5756