View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0817_low_34 (Length: 251)

Name: NF0817_low_34
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0817_low_34
NF0817_low_34
[»] chr1 (1 HSPs)
chr1 (1-221)||(44984620-44984838)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 44984620 - 44984838
Alignment:
1 attattctctttcttacttggtaaacaagtttgttgaacgtacaaaaatgcaaaagaattggatcctatattgacatgattaggaaaatgaaatcgtatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
44984620 attattctctttcttacttggtaaacaagtttgttgaacgtacaaaaatgcaaaagaattggatcctatattgacatgattaggaaaatgaaatcgtat- 44984718  T
101 ataagagagagaattagaaaagattgaaggagcgtaagttttatgttaaaatttcaacggtgaaaagagcatgcaatgcaatagcaagaaaaatgtgggg 200  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44984719 --aagagagagaattagaaaagattgaaggagcgtaagttttatgttaaaatttcaacggtgaaaagagcatgcaatgcaatagcaagaaaaatgtgggg 44984816  T
201 atgctt-accaaaatgaattac 221  Q
    |||||| |||||||||||||||    
44984817 atgcttaaccaaaatgaattac 44984838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6557 times since January 2019
Visitors: 5769