View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_low_34 (Length: 251)
Name: NF0817_low_34
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0817_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 44984620 - 44984838
Alignment:
Q |
1 |
attattctctttcttacttggtaaacaagtttgttgaacgtacaaaaatgcaaaagaattggatcctatattgacatgattaggaaaatgaaatcgtatt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44984620 |
attattctctttcttacttggtaaacaagtttgttgaacgtacaaaaatgcaaaagaattggatcctatattgacatgattaggaaaatgaaatcgtat- |
44984718 |
T |
 |
Q |
101 |
ataagagagagaattagaaaagattgaaggagcgtaagttttatgttaaaatttcaacggtgaaaagagcatgcaatgcaatagcaagaaaaatgtgggg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44984719 |
--aagagagagaattagaaaagattgaaggagcgtaagttttatgttaaaatttcaacggtgaaaagagcatgcaatgcaatagcaagaaaaatgtgggg |
44984816 |
T |
 |
Q |
201 |
atgctt-accaaaatgaattac |
221 |
Q |
|
|
|||||| ||||||||||||||| |
|
|
T |
44984817 |
atgcttaaccaaaatgaattac |
44984838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6557 times since January 2019
Visitors: 5769