View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0817_low_8 (Length: 410)
Name: NF0817_low_8
Description: NF0817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0817_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 17 - 381
Target Start/End: Original strand, 32143898 - 32144262
Alignment:
Q |
17 |
tgctgggaaaggcctgaaaacatgactgagaaaaggccactcactcaagttaactcatcttttccaggaacagaagttgcagcagaaacagcagctgcac |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32143898 |
tgctgggaaaggcctgaaaacatgactgagaaaaggccactcactcaagttaactcatcttttccaggaacagaagttgcagcagaaacagcagctgcac |
32143997 |
T |
 |
Q |
117 |
ttgccgcagcatctttggtttttaaggagattaatctcacttattctgagattcttcttgaacatgctcagcaactgtttattttcgctgatacatacag |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
32143998 |
ttgccgcagcatctttggtttttaaggagattaatctcacttattctgagattcttcgtgaacatgctcagcaactgtttatgttcgctgatacatacag |
32144097 |
T |
 |
Q |
217 |
agtttcctacagtgtcagtatccctcaagttggaaaatactataactcatctggttatggagatgaacttttatgggccagtagttggctctatcatgca |
316 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32144098 |
agtttcctacagtgtcagtatccctcaagttggaaaatactataactcatctggttatggagatgaacttttatgggctagtagttggctctatcatgca |
32144197 |
T |
 |
Q |
317 |
acaaaggatccctcataccttacttatgtgacagagacgaatgaaaatgagtttggtagtatagg |
381 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32144198 |
acaaaggatccctcataccttacttatgtgacagagacgaatgaaaatgagtttggtagtatagg |
32144262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4528 times since January 2019
Visitors: 5751