View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0818_high_39 (Length: 301)

Name: NF0818_high_39
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0818_high_39
NF0818_high_39
[»] chr2 (1 HSPs)
chr2 (171-218)||(36956166-36956213)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 36956166 - 36956213
Alignment:
171 ttgggttgagtagagagaagtacttactacatgttgcagtatggagac 218  Q
    |||||||| ||||||||||||||||||||||||||||||||| |||||    
36956166 ttgggttgtgtagagagaagtacttactacatgttgcagtatagagac 36956213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University