View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_43 (Length: 299)
Name: NF0818_high_43
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_high_43 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 66 - 299
Target Start/End: Complemental strand, 16827085 - 16826851
Alignment:
| Q |
66 |
caatgatttattgtaatccattattaacagttgctaattatatatgattatgaaatgtcactatatattatggtatctatgtgcctgtgaggaaagggtg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16827085 |
caatgatttattgtaatccattattaacagttgctagttatatatgattatgaaatgtcactatatattatggtatctatgtgcctgtgaggaaagggtg |
16826986 |
T |
|
| Q |
166 |
tttataatggatcatcaaaactacaaccacacacgtggttctcatgaacttcttttaccaaagc-tactataaattatgctctttgaaccttccagaaat |
264 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16826985 |
ttgataatggatcatcaaaatgacaaccacacacgtggttctcatgaacttcttttaccaaagcttactatatattatgctctttgaaccttccagaaat |
16826886 |
T |
|
| Q |
265 |
agatatataggttgattaacaataaaaacatatct |
299 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||||| |
|
|
| T |
16826885 |
agatatatagattaattaacaataaaaccatatct |
16826851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 35286119 - 35286058
Alignment:
| Q |
7 |
taagggtccctcaaatattaacagaaaatgaaggaccccccaggggagggtagcagaggcaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35286119 |
taagggtccctcaaatattaacagaaaatgaaggaccccccaggggagggtagcagaggcaa |
35286058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7 times since January 2019
Visitors: 5846