View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_45 (Length: 290)
Name: NF0818_high_45
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 37056722 - 37056549
Alignment:
| Q |
1 |
tattgaaatggaagttctaggttttagagtccagcgttgggtaacaaatccgcatagttgaacctggatacctttcaccatcattcttcttcttcttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37056722 |
tattgaaatggaagttctaggttttagagtccagcgttgggtaacaaattcgcatagttgaacctggatacctttcaccatcattcttcttc---ttctc |
37056626 |
T |
 |
| Q |
101 |
cgattggaatttccaactacaaaacacactttttctttacacaacaaaacactccgtattcctatttcaccgccaca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37056625 |
cgattggaatttccaactacaaaacacactttttctttacacaacaaaacactccgtattcctatttcaccgccaca |
37056549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 5570461 - 5570408
Alignment:
| Q |
4 |
tgaaatggaagttctaggttttagagtccagcgttgggtaacaaatccgcatag |
57 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
5570461 |
tgaaatggaatttctaggtttaagagtccagcgttggctaacaaatccacatag |
5570408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University