View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_51 (Length: 271)
Name: NF0818_high_51
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 98 - 249
Target Start/End: Complemental strand, 37112667 - 37112515
Alignment:
| Q |
98 |
cagaagcagggtaatattcatactgttccgttataaaacccaaggttttgcttctattgcattgaaaaacaaagcaaaaga-ttgaatttctcaaagcaa |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37112667 |
cagaagcagggtaatattcatatcgttcctttataaaacccaaggttttgcttctattgcattgaaaaacaaagcaaaagagttgaatttctcaaagcaa |
37112568 |
T |
|
| Q |
197 |
tggggttaccaactcctacccttcactttctccttcaaattcttcttgtctct |
249 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37112567 |
tggggttaccaattcctacccttcactttctccttcaaattcttcttgtctct |
37112515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 514 times since January 2019
Visitors: 5839