View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0818_high_56 (Length: 251)

Name: NF0818_high_56
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0818_high_56
NF0818_high_56
[»] chr3 (1 HSPs)
chr3 (1-242)||(7855393-7855633)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 7855633 - 7855393
Alignment:
1 atcaacggcatgaacgagattctagcgagtacaagaaatgttgaaacaaaccaatgacttcttgattgtaatctttcaaaaatcaaaattgatgaaggaa 100  Q
    |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7855633 atcaaccgcatgaacgagattttagcgagtacaagaaatgttgaaacaaaccaatgacttcttgattgtaatctttcaaaaatcaaaattgatgaaggaa 7855534  T
101 tgaagtccaaagctttaacatgttctatatgtttggcggatctcttggttggatcgatagcaattcagttgtcatgttcgcatttgtaccatgaaagagt 200  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
7855533 tgaagtccaaagctttaacatgttctatatgtttggtggatctctcggttggatcgatagcaattcagttgtcatgttcgcatttgtaccatg-aagagt 7855435  T
201 gtgttgtaaaatggctagatagatcaaacacctgccctttgt 242  Q
    |||||||||||||||||||||||||||||||||  |||||||    
7855434 gtgttgtaaaatggctagatagatcaaacacctttcctttgt 7855393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 133 times since January 2019
Visitors: 5849