View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_58 (Length: 251)
Name: NF0818_high_58
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_high_58 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 51844057 - 51843836
Alignment:
| Q |
30 |
gatacaattttcattcaattggatgagttcaagaataaacaaacctccaattggctgaactataagaattaactttaaatatccaaaatttgagagcgtg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844057 |
gatacaattttcattcaattggatgagttcaagaataaacaaacctccaattggctgaactataagaattaactttaaatatccaaaatttgagagcgtg |
51843958 |
T |
|
| Q |
130 |
cgagaagatgtggattttgtagagttgaagagggacaacaacaacccccatgcttttgttttgtctttgatatgtcgtgcttggggtaatttttaattcc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51843957 |
cgagaagatgtggattttgtagagttgaagagggacaacaacaacccccatgcttttgttttgtctttgatatgtcgtgcttggggtaatttttaattcc |
51843858 |
T |
|
| Q |
230 |
ttcaaggaaggagaagaggatt |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51843857 |
ttcaaggaaggagaagaggatt |
51843836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 211 - 246
Target Start/End: Original strand, 51843789 - 51843824
Alignment:
| Q |
211 |
tggggtaatttttaattccttcaaggaaggagaaga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51843789 |
tggggtaatttttaattccttcaaggaaggagaaga |
51843824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 79
Target Start/End: Original strand, 51844957 - 51845001
Alignment:
| Q |
35 |
aattttcattcaattggatgagttcaagaataaacaaacctccaa |
79 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
51844957 |
aattttcatgcaattggttgagttcaagagtaaataaacctccaa |
51845001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 430 times since January 2019
Visitors: 5836