View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_63 (Length: 250)
Name: NF0818_high_63
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_high_63 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 17233490 - 17233249
Alignment:
| Q |
9 |
gaagaatatgatcaaaagtttaaagaaataatcctttggaataaacatgatgaagtatttattgtctcaaataacaacactagaaagaaatttacagatg |
108 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17233490 |
gaagaaaatgattaaaagtttaaagaaatactcctttggaataaacaatatgaagtgtttattgtctcaaataacaacactagaaagaaattcacagatg |
17233391 |
T |
 |
| Q |
109 |
ttgctctgtagcagtctggcaaatttttcaagagtgaagagtgcactatgaataggaactgcaaccgcaagcaataagaatgagaaccccataagggcct |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17233390 |
ttgctctgaagcagtctggcaaatttttcaagagtgaagagtgcactatgaataagaaccgcaaccgcaagcaataagaatgagaaccccataagggcct |
17233291 |
T |
 |
| Q |
209 |
aatatgtgcaacaacacccaccgcaaagaaatgacacaagga |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
17233290 |
aatatgtgcaacaacacccaccacaaagaaatgacactagga |
17233249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University