View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_65 (Length: 244)
Name: NF0818_high_65
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 28485293 - 28485064
Alignment:
Q |
1 |
aaatgtattaatttattaacatacttcatattagaaagattttgataaagcaagttctttatccacaannnnnnnnnnnnnnnnc--cttaacgctcctt |
98 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
28485293 |
aaatgtattaatttattaacatgattcatattagaaagattttgataaagcaagttctttatccacaattattttttatttttttttcttaacgctcctt |
28485194 |
T |
 |
Q |
99 |
cc-----gaaggagaccctggtaattcggagtttagctgggaggtaagtaaagtctgtctgatcaacattcagctgatcgaccatggatctattgctcta |
193 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28485193 |
cctctaggaaggagaccctggtaattcggagtttagctgggaggtaagtaaagtctgtctgatcaacattcagctgatcgaccatggatctattgctcta |
28485094 |
T |
 |
Q |
194 |
ataaaaaatactcaataactatatagtttc |
223 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
28485093 |
ataaaaaatactcaataactatatagtttc |
28485064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 463 times since January 2019
Visitors: 5838