View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_high_68 (Length: 225)
Name: NF0818_high_68
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 38543970 - 38544189
Alignment:
Q |
1 |
gcttggaaaatatttaggaatcaaagataaatgtaaacatgaaaattggtgagactatcattgcgtatacgttagatacattagggaataagcatcctaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
38543970 |
gcttggaaaatatttaggaatcaaagataaatgtaaacatgaaaattggcgagactatcattgcgtatacgttagatacattagggaataagca-cctaa |
38544068 |
T |
 |
Q |
101 |
gtcgtatatttcatgtgcttttttctctcagttacacgtgatatcacacatcccatatgactgaaaatagtgatcgccgggtctatgtatgtattatcat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| ||| ||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38544069 |
gtcgtatatttcatgtgcttttttctctcaattatacgtgatgtaacacatcccatatgtctgaaaatagtgatcgccgggtctatgtatgtattatcat |
38544168 |
T |
 |
Q |
201 |
cggcttacatcgtagtcgtgg |
221 |
Q |
|
|
|||||||| |||||||||||| |
|
|
T |
38544169 |
cggcttacgtcgtagtcgtgg |
38544189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University