View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_101 (Length: 240)
Name: NF0818_low_101
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_101 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 29960229 - 29960012
Alignment:
Q |
19 |
aataataaactttcacatcttgtaaaaagtaagacgtatatgtatgtatatgattgtctatattttgtattcattttctggactacgtacgtggttgcat |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29960229 |
aataataaactttcacatcttgtaaaaagtaagacgtatatatat----atgattgtctatattttgtattcattttctggactacgtacgtggttgcat |
29960134 |
T |
 |
Q |
119 |
tgcatgcattgtatagtactaaagaaattaaattttctagagaagatagttttccaattttagatatgtggttacatttgaatagaagctatttttaatt |
218 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
29960133 |
tgcatgcattctatagtactaaagaaattaaatttcctagagaagatagttttccaattttagatatgtggttacatttgaatagaagctattattaatt |
29960034 |
T |
 |
Q |
219 |
gggtcaagtgtgaatcggatta |
240 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
29960033 |
gggtcaagtgtgaatcggatta |
29960012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 520 times since January 2019
Visitors: 5839