View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_102 (Length: 240)
Name: NF0818_low_102
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_102 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 13 - 139
Target Start/End: Original strand, 25713662 - 25713792
Alignment:
| Q |
13 |
ttcttatatttcacttatttccacctgctcctctttgtttgtccctctgcctcactatcaacctttgttatcccttattttccactgttgatcccctc-- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25713662 |
ttcttatatttcacttatttccacctgctcctctttgtttgcccctctgcctcactatcaacctttgttatcccttattttccactgttgatcccccctc |
25713761 |
T |
|
| Q |
111 |
--atgcacctcatcatcttatcttctgtgct |
139 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
25713762 |
atatgcacctcatcatcttatcttttgtgct |
25713792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 506 times since January 2019
Visitors: 5839