View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_103 (Length: 228)
Name: NF0818_low_103
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 28022775 - 28022982
Alignment:
Q |
8 |
gagatgaaacagaaacagttactctcattgttgatccactgccatcagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggcta |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28022775 |
gagatgaaacagaaacagttactctcattgttgatccgctgccatcagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggcta |
28022874 |
T |
 |
Q |
108 |
tgtgagggtgaaggagaccgataaggtgagtgacctgtgcgacaaagtttcacgatattggggcattccccttgatactttcacccttcatcgtctcaat |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28022875 |
tgtgagggtgaaggagaccgataaggtgagtgacctgtgcaacaaagtttcacggtattggggcattccccttgatactttcacccttcatcgtctcaat |
28022974 |
T |
 |
Q |
208 |
gttgaaat |
215 |
Q |
|
|
|||||||| |
|
|
T |
28022975 |
gttgaaat |
28022982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University