View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_48 (Length: 351)
Name: NF0818_low_48
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 33 - 153
Target Start/End: Complemental strand, 33377061 - 33376941
Alignment:
| Q |
33 |
tctctgtataagaagaatagggactgataagataaaaactagaaagcaaaaaacacactatataaatggagcatcgaaaaacaaatgtatgttgtatgca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||| || |||||||| ||||||| ||||| |||||| ||| |||||||| |
|
|
| T |
33377061 |
tctctgtataagaagaatagggactgataagatagaaactagaaagtaaaaaacgcattatataaacggagcattgaaaagcaaatgcatgctgtatgca |
33376962 |
T |
|
| Q |
133 |
ccatacattttaaacaccaag |
153 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33376961 |
ccatacattttaaacaccaag |
33376941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 232 - 285
Target Start/End: Complemental strand, 33376864 - 33376811
Alignment:
| Q |
232 |
gattattgtttgttgttttctaccagtgctttctctatcctttatttcttttct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33376864 |
gattattgtttgttgttttctaccagtgctttctctatcctttatttgttttct |
33376811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 222 times since January 2019
Visitors: 5833