View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_52 (Length: 322)
Name: NF0818_low_52
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 30 - 317
Target Start/End: Complemental strand, 27099000 - 27098713
Alignment:
Q |
30 |
gaagtgatgggaggaggaagaggtaccggacgaaatttacgccggatcagaaggagaagatgatgggatttgctgagaagttaggatggaaattgcagag |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27099000 |
gaagtgatgggaggaggaagaggtaccggacgaaatttacgccggatcagaaggagaagatgatgggatttgctgagaagttaggatggaaattgcagag |
27098901 |
T |
 |
Q |
130 |
aaaagaacttgatgaagagattgaaaggttttgtgaaagtgttggtgtgagtagacaagtttttaaggtttggatgcataatcataagaattcttgtttc |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27098900 |
aaaagaacttgatgaagagattgaaaggttttgtgaaagtgttggtgtgagtagacaagtttttaaggtttggatgcataatcataagaattcttgtttc |
27098801 |
T |
 |
Q |
230 |
tcaaattcttctgatccttctactggtaatgctaattcctctcttactcagtagtgtgtgtgaagaatttcaattacttcatctcact |
317 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
27098800 |
tcaaattcttctgatccttctactggtaatgctaattcctctcttactcagtagtgtgtgtgaagaatttcaattacttcatttcact |
27098713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 407 times since January 2019
Visitors: 5835