View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_56 (Length: 317)
Name: NF0818_low_56
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 113 - 269
Target Start/End: Original strand, 46744922 - 46745093
Alignment:
| Q |
113 |
atatagtatagataagttcttacaaaagaagactaaaaaacagtctaggaatttcgttattaatcaagaatcactat--------------atacatggn |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46744922 |
atatagtatagataagttcttacaaaaaaagactaaaaaatagtctaggaatttcgttattaatcaagaatcactatatacaagatggagtatacatgga |
46745021 |
T |
 |
| Q |
199 |
nnnnnnnn-tccagggaatggaagagataaaactactctattagattgtactttagcttatccttccgacac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46745022 |
aaaaaaaaatccagggaatggaagagataaaactactctattagattgtactttagcttatccttccaacac |
46745093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 46744821 - 46744863
Alignment:
| Q |
7 |
ccaaatgcctctttacttccccacatcttgtccgaagggtacc |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46744821 |
ccaaatgcctctttacttccccacatcttgtccgaagggtacc |
46744863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 309
Target Start/End: Complemental strand, 14329869 - 14329840
Alignment:
| Q |
280 |
cctccacatttggatgcaattatctgtgct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14329869 |
cctccacatttggatgcaattatctgtgct |
14329840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University