View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_57 (Length: 314)
Name: NF0818_low_57
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 28022900 - 28022620
Alignment:
| Q |
1 |
ccttatcggtctccttcaccctcacatagccattgctgccatggccaagaaacttcactaaaacatgtagtttcaggtctgatggcagtggatcaacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28022900 |
ccttatcggtctccttcaccctcacatagccattgctgccatggccaagaaacttcactaaaacatgtagtttcaggtctgatggcagcggatcaacaat |
28022801 |
T |
|
| Q |
101 |
gagagtaactgtttctgtttcatctccgcacaaagcatagaatccaatccttttctcattatccaactctatacccttgtaccagagattttgcctgtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022800 |
gagagtaactgtttctgtttcatctccgcgcaaagcatagaatccaatccttttctcattatccaactctatacccttgtaccagagattttgcctgtgt |
28022701 |
T |
|
| Q |
201 |
actcccacctccaactcgtcttcgattttgcttttaagatcaaaaacaagttctgataccgatatttctaccacaggttct |
281 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022700 |
actcccacctccaactcgttttcgattttgcttttaagatcaaaaacaagttctgataccgatatttctaccacaggttct |
28022620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 148 times since January 2019
Visitors: 5832