View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_59 (Length: 312)
Name: NF0818_low_59
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 262
Target Start/End: Complemental strand, 46047203 - 46046954
Alignment:
Q |
13 |
aatatcagaacgaatgcaattaattaattctgatttttgtgcatatatctctaaatagtgggtgaagatataaaagatagtgctgaatatgtcatcacac |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46047203 |
aatatcagaacgaatgcaattaattaattctgatttttgtgcatatatctctaaatagtgggtgaagatataaaagatagtgctgaatatgtcatcacac |
46047104 |
T |
 |
Q |
113 |
acatgcatcttgagcacatatatacatatccatctagaaacttgctgagattttgatgcatttgaccttcaaccattgaaaccctttcttcaaagaacgt |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46047103 |
acatgcatcttgagcacatatatacatatccatctagaaacttgctgagattttgatgcatttgaccttcaaccattgaaaccctttcttcaaagaacgt |
46047004 |
T |
 |
Q |
213 |
ttcagcttaccttcggtcccataaaacttgtatctggccactctcctctt |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46047003 |
ttcagcttaccttcggtcccataaaacttgtatctggccactctcctctt |
46046954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1165 times since January 2019
Visitors: 5827