View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_62 (Length: 302)
Name: NF0818_low_62
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 250
Target Start/End: Original strand, 36956166 - 36956245
Alignment:
Q |
171 |
ttgggttgagtagagagaagtacttactacatgttgcagtatggagacggnnnnnnnnntaattgggttgcaggtctgtg |
250 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||| |
|
|
T |
36956166 |
ttgggttgtgtagagagaagtacttactacatgttgcagtatagagacagaaaaaaatataattgggttgcaggtctgtg |
36956245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University