View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_70 (Length: 291)
Name: NF0818_low_70
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 37056698 - 37056891
Alignment:
| Q |
1 |
aaaacctagaacttccatttcaatatcatcactctccccaatttcacacccttatctttctctcaaactccttcccacgcacaccacacctcgcaccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37056698 |
aaaacctagaacttccatttcaatatcatcactctgcccaatttcacacccttatctttctctcaaactccttcccacgcacaccacacctcgcaccact |
37056797 |
T |
|
| Q |
101 |
cgattcgcaccgtttcgtgcttcctcatcgcttcaatcttccgtaagttctctctccccaagaattccgtgtttatcagattttcttcgttccc |
194 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37056798 |
cgattttcaccgtttcgtgcttcctcatcgcttcaatcttccgtaagttctctctccccaagaattccgtgtttatcagattttcttcgttccc |
37056891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 29 - 167
Target Start/End: Original strand, 5570459 - 5570602
Alignment:
| Q |
29 |
tcactctccccaatttcacacccttatctttctctcaaactccttcccacgcacaccacacct------cgcaccactcgattcgcaccgtttcgtgctt |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||| ||||||| |||||| ||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
5570459 |
tcactctccccaatttcacaccctaatccttctctcgaactctttcccac-cacacctcaccttgcaatcgcaccgctcgattcgcaccctttcgtgctt |
5570557 |
T |
|
| Q |
123 |
cctcatcgcttcaatcttccgtaagttctctctccccaagaattc |
167 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||||| || ||||| |
|
|
| T |
5570558 |
cctcatcgcttcaatcttctgtaagttatatctcccaaataattc |
5570602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 502 times since January 2019
Visitors: 5839