View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_74 (Length: 283)
Name: NF0818_low_74
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 99 - 282
Target Start/End: Original strand, 6145876 - 6146059
Alignment:
| Q |
99 |
ttttctctaccaaagctgctactatcattgttaaaactgaaaaaaccattccagcaccgatcctttgaagaatgttcatccctctttcattgccgcttat |
198 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6145876 |
ttttctcgaccaaagctgctactatcattgttaaaaccgaaaaaaccattccaataccaatcctttgaagaatgttcatccctctttcattgccacttat |
6145975 |
T |
|
| Q |
199 |
ttttcttaaaaccggtacgaggattttgtcgtcgattgcgacagaaattatcatactaatatcggaaatagtgaaaattgaagc |
282 |
Q |
| |
|
|||||||||||| || |||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6145976 |
ttttcttaaaactggcacgaggattttgtcgtaaattgcgacagaaattatcataccaatagcggaaatagtgaaaattgaagc |
6146059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1176 times since January 2019
Visitors: 5827