View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0818_low_78 (Length: 271)

Name: NF0818_low_78
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0818_low_78
NF0818_low_78
[»] chr3 (1 HSPs)
chr3 (98-249)||(37112515-37112667)


Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 98 - 249
Target Start/End: Complemental strand, 37112667 - 37112515
Alignment:
98 cagaagcagggtaatattcatactgttccgttataaaacccaaggttttgcttctattgcattgaaaaacaaagcaaaaga-ttgaatttctcaaagcaa 196  Q
    ||||||||||||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
37112667 cagaagcagggtaatattcatatcgttcctttataaaacccaaggttttgcttctattgcattgaaaaacaaagcaaaagagttgaatttctcaaagcaa 37112568  T
197 tggggttaccaactcctacccttcactttctccttcaaattcttcttgtctct 249  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||    
37112567 tggggttaccaattcctacccttcactttctccttcaaattcttcttgtctct 37112515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 60 times since January 2019
Visitors: 5829