View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_82 (Length: 263)
Name: NF0818_low_82
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_82 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 29959831 - 29959662
Alignment:
| Q |
1 |
ttggtaaaactatatatggttggtcttacatcaatggaattgactttcttgggagcttttcttgccgtctgggacattgttgttcttttgctgtaccttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959831 |
ttggtaaaactatatatggttggtcttacatcaacggaattgactttcttgggagcttttcttgccgtctgggacattgttgttcttttgctgtaccttg |
29959732 |
T |
|
| Q |
101 |
ataataatcacactgaaaaagaaaattgcatcatactgataattaaattttgacagtgatctcgtagact |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
29959731 |
ataataatcacactgaaaaagaaaattgcatcacattgataattaaattttgacagtgatctcgtagact |
29959662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 401 times since January 2019
Visitors: 5835