View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_83 (Length: 263)
Name: NF0818_low_83
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_83 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 22267205 - 22267053
Alignment:
Q |
1 |
agatgggataaaaacgggaaacatggatggctatgtaggttttcatgctgctttaaggtgtgcttacactcggttcttaaaggatcttgctaagcagtgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22267205 |
agatgggataaaaacgggaaacatggatggctatgtaggttttcatgctgctttaaggtgtgcttacactcggttcttaaaggatcttgctaagcagtgc |
22267106 |
T |
 |
Q |
101 |
aagcagcttgttaggcaccaccttgattcagttaccagtccatactcacaggt |
153 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22267105 |
aagcagcttgttaggcaccaccttgattcagttaccagtccatactcacaggt |
22267053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University