View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_85 (Length: 257)
Name: NF0818_low_85
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 1839859 - 1839993
Alignment:
| Q |
1 |
ggtggtagtactggtaggaacaacagttgcagctgattcagcaccaaataactgcattcacatgacttgtggaggtaaagaaattccatatccatttggt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1839859 |
ggtggtagtactagtaggaacaacagttgcagctgattcagcaccaaataactgcagtcacatgacttgtggaggtatagaaattccatatccatttggt |
1839958 |
T |
 |
| Q |
101 |
atagaactcaacaactcttcatcaaattgtttcat |
135 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1839959 |
atagacctcaacaactcttcatcaaattgtttcat |
1839993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 1865805 - 1865906
Alignment:
| Q |
1 |
ggtggtagtactggtaggaacaacagttgcagctgattcagcaccaaataactgcattcacatgacttgtggaggtaaagaaattccatatccatttggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
1865805 |
ggtggtagtactggtaggaacaacagttgcagctgattcagcaacaaatacttgcagtcac---acttgtggaggtcaagaaattccatatccatttggc |
1865901 |
T |
 |
| Q |
101 |
ataga |
105 |
Q |
| |
|
||||| |
|
|
| T |
1865902 |
ataga |
1865906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 22 - 99
Target Start/End: Complemental strand, 1833119 - 1833042
Alignment:
| Q |
22 |
aacagttgcagctgattcagcacca---aataactgcattcacatgacttgtggaggtaaagaaattccatatccatttgg |
99 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
1833119 |
aacagttgcagctgattcaacaccattaaatacctgcagtcaca---cttgtggagataaagaaattccatatccatttgg |
1833042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University