View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_88 (Length: 252)
Name: NF0818_low_88
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_88 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 252
Target Start/End: Complemental strand, 35857327 - 35857083
Alignment:
Q |
8 |
ccaacaaaattaaacgcaatgttaatttcaaacagagctttccatttgtctggtatataaaaacattgtcttgaacgttcttcaatcattgccgtaatta |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
35857327 |
ccaacaaaattaaacgcaatgttaatttcaaactgagctttccatttgttaggtatataaaaacattatcttgaacgttcttcaatcattgccgtaatta |
35857228 |
T |
 |
Q |
108 |
gcacacgaaaaaataaatcattactgatttgctgctactgtaacacgctactttttgatagaaatacataaaagtatatgattatttagttttaaatata |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
T |
35857227 |
gcacacgaaaaaataaatcattactgatttgctgctactgtaacacgctactttttgatagaaatacataaaagtatatgagtatttagttttaaatttt |
35857128 |
T |
 |
Q |
208 |
ttttatttttgacatagagatgataatactcataagatgacgagc |
252 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35857127 |
ttttatttttgacatagagatgataatactcataagatgacgagc |
35857083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 51 times since January 2019
Visitors: 5846